Transposable Element Finder (TEF) is a program for detecting active transposable elements (TEs) by comparing two NGS sequences. TEF does not require prior TE information to detect transposition. Instead, it returns information about transposed transposon ends and their positions on the reference genome.

Active TEs transpose on the host genome. Because transposition events are independent, the inserted positions of TEs should differ between two samples. Short read sequences from both samples should contain different fusion fragments of genome and TE sequences. Most TEs create target site duplication (TSD) at the insertion position. TEF detects both ends of the TE and the insertion position on the genome using TSD information from NGS short reads.

TEF runs on Unix (Linux and FreeBSD) machines. 8 or 16GB of memory is sufficient. One or more TB of disk space (SSD is better) is required. To analyze NGS data of humans, 4 or more TB of disk space is recommended.

Web page : https://akiomiyao.github.io/tef/

For example,

perl tef.pl a=ttm2,ref=IRGSP1.0  
perl tef.pl a=ttm2,b=ttm5,ref=IRGSP1.0  

Options are separated by commas WITHOUT spaces.

With the new feature, you can now omit the b parameter. When b is omitted, TEF will use the reference genome specified by ref as the second set of data. This means TEF will compare the NGS reads specified by a directly with the reference genome to detect transpositions.

TEF is implemented with junction and TSD methods. The default is the junction method.

If the tsd_size option is specified, TEF will run with the TSD method. For example,

perl tef.pl a=ttm2,b=ttm5,ref=IRGSP1.0,tsd_size=5  

The th option is threshold for filtering same TSD sequence.
Default = 0.2
If too many noises are detected, increase th value, e.g. th=0.7.

perl tef.pl a=ttm2,b=ttm5,ref=IRGSP1.0,th=0.7  

The th option is TSD method specific.

Because temporary directories in targets grow to a huge size, they will be deleted at the end of the analysis. If debug=yes is added to the options, temporary directories will not be deleted.

sort_tmp=directory_for_sort is the option for specifying a temporary directory for the sort command. If sort_tmp is specified to a fast disk, e.g., SSD, sorting will be accelerated. If your SSD is not large enough, set the TEF directory in HDD space and specify sort_tmp in SSD space.

For Linux, the max_process is limited to the number of CPU cores. For other OS, the default process number is 4. If you add the max_process option, e.g., max_process=8, TEF will use 8 cores.

perl tef.pl a=ttm2,b=ttm5,ref=IRGSP1.0,tsd_size=5,th=0.7,option=clear,sort_tmp=/mnt/ssd/tmp,max_process=8

Additionally, if an error occurs and the program stops, execute ulimit -n 4096 before running this program. This will increase the limit on the number of files that can be opened at once.

Clone the repository:

git clone https://github.com/akiomiyao/tef.git   

for updating tef.pl

cd tef  
git pull  

First, create directories specified by a and b.

For example,

cd tef  
mkdir IRGSP1.0  # If tef.pl runs without ref directory, tef.pl makes ref directory and exits.
cd IRGSP1.0  
wget  https://rapdb.dna.affrc.go.jp/download/archive/irgsp1/IRGSP-1.0_genome.fasta.gz  
cd ..  
mkdir ttm2  
mkdir ttm2/read  
cp somewhere/SRR556173_1.fastq somewhere/SRR556173_2.fastq ttm2/read  
mkdir ttm5  
mkdir ttm5/read  
cp somewhere/SRR556174_1.fastq somewhere/SRR556174_2.fastq somewhere/SRR556175_1.fastq somewhere/SRR556175_2.fastq ttm5/read  
ulimit -n 4096
perl tef.pl a=ttm2,b=ttm5,ref=IRGSP1.0

FASTQ files should be saved in the read directory in targets. Files compressed with gz, bzip2, and xz formats can be processed.

Results are saved in the ttm2 directory, specified by a.

After the commit of f52457f, tef.pl opens more than 1000 files simultaneously. Setting ulimit -n 4096 may be required before running tef.pl.

When you first run tef.pl, an empty directory specified by the reference name is created. Save the gzipped FASTA file for the reference into this directory, and then run tef.pl again.

After the second run of tef.pl, a config file is created in the reference directory. The config file contains a list of chromosome names in the order they appear in the FASTA file. If necessary, rename or change the chromosome names in the config file to ���NOP”. For partial contigs or extra chromosomes that are not required, replace the chromosome name with “NOP”. If there are too many partial contigs to ignore, create a config file with all lines set to “NOP” and then replace the desired chromosome names at the relevant positions.

On the third run, ped.pl creates the reference data set according to the config file and then proceeds with the main routine. Once the reference data set is created, it can be reused for additional analyses. If the reference data is incomplete or corrupted, delete the reference directory and run tef.pl again.

Usage

perl sliceTE.pl path_of_reference_genome head_sequence tail_sequence

The sliceTE.pl outputs sequences between head and tail sequences from the FASTA file of the reference genome. Options should be separated by a single space.

The range of TE size can be adjusted on line 54 of sliceTE.pl.

FASTA files compressed by gzip, bzip2, and xz can be processed.

For example,

perl sliceTE.pl IRGSP1.0/IRGSP-1.0_genome.fasta.gz TGTTAAATATATATACAAGC AGGTTGCAAGTTAGTTAAGA

The sliceRef.pl outputs sliced sequences from the chromosome sequence in the reference directory.

For example,

perl sliceRef.pl IRGSP1.0/chr7 26694795 26698908

The chromosome sequence should be the output of tef.pl.

• 1.5 Now possible to detect transpositions by comparing a single set of read data with a reference genome sequence. 2025-04-23
• 1.4 Improved accuracy of TE detection. 2023-12-14
• 1.3 Insertion direction of TE is shown with same format of version 1.0. 2023-10-09
• 1.2 Correct output transposed positions. Add filter for ambigure TSDs. 2023-09-18
• 1.1 Improve junction method. Large genome data (even human) can be applicable. 2023-08-23
• 1.0 Initial version. 2022-03-29

Miyao, A., Yamanouchi, U. Transposable element finder (TEF): finding active transposable elements from next generation sequencing data. BMC Bioinformatics 23, 500 (2022). https://doi.org/10.1186/s12859-022-05011-3

Free of use for academics. For non-academics, license by NARO (same as PED) is required.
Patent JP 7573862.

Akio Miyao miyao.akio700@naro.go.jp